Top » Catalog » SNPs » Z30781

$18.00

Z30781
[Z30781]

Z30781
hg38 Position: ChrY:14526382..14526382
Ancestral: A
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b2a1a1a1a1a1b
Comments: Subgrp under Z29424
Forward Primer: Z30781_F TAGTTGGCCCTGGTGAAG
Reverse Primer: Z30781_R CCTCCGATTTTAATCCACTG
Reviews

Customers who bought this product also purchased
L1263
L1263
S9751
S9751
Z6764
Z6764
U1
U1
BY45254
BY45254
L140
L140
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies