Top » Catalog » SNPs » Z30781

$18.00

Z30781
[Z30781]

Z30781
hg38 Position: ChrY:14526382..14526382
Ancestral: A
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: G2a2b2a1a1a1a1a1b
Comments: Subgrp under Z29424
Forward Primer: Z30781_F TAGTTGGCCCTGGTGAAG
Reverse Primer: Z30781_R CCTCCGATTTTAATCCACTG
Reviews

Customers who bought this product also purchased
L140
L140
Z29424
Z29424
G2a-L1259 Panel
G2a-L1259 Panel
L1263
L1263
S9751
S9751
Z6764
Z6764
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies