Top » Catalog » SNPs » BY9745

$18.00

BY9745
[BY9745]

BY9745
hg38 Position: ChrY:15250545..15250545
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1
Comments: .
Forward Primer: BY9745_F GCTTATTTCACTTAATCTAGCTGTTTCAC
Reverse Primer: BY9745_R CTAGATCACGTCCCAAAGACG
Reviews

Customers who bought this product also purchased
MZ136
MZ136
MZ90
MZ90
Z5009
Z5009
M81
M81
MZ147
MZ147
E1b-L19 Panel
E1b-L19 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4634
$18.00
Haplogroup Info
Other products
Currencies