Top » Catalog » SNPs » MZ146

$18.00

MZ146
[MZ146]

MZ146
hg38 Position: ChrY:8412347..8412347
Ancestral: T
Derived: C
Reference: Hamma Bachir (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of MZ136
Forward Primer: MZ146vl_F CCTCAAGCTGGAGTGTGTTG
Reverse Primer: MZ146vl_R CTAAAATTTTCTTAAGACGGAGAATAAGATAC
Reviews

Customers who bought this product also purchased
M81
M81
E1b-L19 Panel
E1b-L19 Panel
MZ138
MZ138
MZ136
MZ136
Z5009
Z5009
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies