Top » Catalog » SNPs » CTS4329

$18.00

CTS4329
[CTS4329]

CTS4329
hg38 Position: ChrY:13469057..13469057
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1a (not listed)
Comments: Below L1026 > Z1933
Forward Primer: CTS4329_F CCCATAGAGCATGCTACGTC
Reverse Primer: CTS4329_R CCTAGGCAACAGAGCAAGG
Reviews

Customers who bought this product also purchased
BY22115
BY22115
L1026
L1026
FT103360
FT103360
M7414
M7414
FT25036
FT25036
Z34986
Z34986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies