Top » Catalog » SNPs » CTS4329

$18.00

CTS4329
[CTS4329]

CTS4329
hg38 Position: ChrY:13469057..13469057
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1a (not listed)
Comments: Below L1026 > Z1933
Forward Primer: CTS4329_F CCCATAGAGCATGCTACGTC
Reverse Primer: CTS4329_R CCTAGGCAACAGAGCAAGG
Reviews

Customers who bought this product also purchased
VL60
VL60
VL72
VL72
Y17790
Y17790
L1032
L1032
L550
L550
Y28538
Y28538
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies