Top » Catalog » SNPs » CTS4329

$18.00

CTS4329
[CTS4329]

CTS4329
hg38 Position: ChrY:13469057..13469057
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: N1a (not listed)
Comments: Below L1026 > Z1933
Forward Primer: CTS4329_F CCCATAGAGCATGCTACGTC
Reverse Primer: CTS4329_R CCTAGGCAACAGAGCAAGG
Reviews

Customers who bought this product also purchased
MF14557
MF14557
Y19455
Y19455
Y13851
Y13851
Y19453
Y19453
YP5256
YP5256
Y19454
Y19454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies