Top » Catalog » SNPs » A13906

$18.00

A13906
[A13906]

A13906
hg38 Position: ChrY:16974452..16974452
Ancestral: A
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2a1a2b (not listed)
Comments: Below L1294 > L1296
Forward Primer: A13906_F GGCCTGACTTGCTAGATTGG
Reverse Primer: A13906_R AAGGCTATGAAGGAGGAATGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies