Top » Catalog » SNPs » A13910

$18.00

A13910
[A13910]

A13910
hg38 Position: ChrY:15838737..15838737
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2a
Comments: Below PH908
Forward Primer: A13910_F GCCTTAGGAAGGAAAAAGTCTTG
Reverse Primer: A13910_R ACCTAGGCTGGCACAATCAG
Reviews

Customers who bought this product also purchased
FT177529
FT177529
PH908
PH908
BY135769
BY135769
I2a-M423 Panel
I2a-M423 Panel
Y56203
Y56203
Y32084
Y32084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies