Top » Catalog » SNPs » A13910

$18.00

A13910
[A13910]

A13910
hg38 Position: ChrY:15838737..15838737
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2a
Comments: Below PH908
Forward Primer: A13910_F GCCTTAGGAAGGAAAAAGTCTTG
Reverse Primer: A13910_R ACCTAGGCTGGCACAATCAG
Reviews

Customers who bought this product also purchased
Y32084
Y32084
A356
A356
FT14506
FT14506
FT177529
FT177529
PH908
PH908
BY135769
BY135769
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies