Top » Catalog » SNPs » A13918

$18.00

A13918
[A13918]

A13918
hg38 Position: ChrY:14753907..14753907
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13918_F CCACTTTGTGTGTTGGGATG
Reverse Primer: A13918_R CTTGAGCCCAGGAAGTTGAG
Reviews

Customers who bought this product also purchased
R1b-A1338 Willard Panel
R1b-A1338 Willard Panel
A13922
A13922
A13921
A13921
A13920
A13920
A13925
A13925
A13919
A13919
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies