Top » Catalog » SNPs » A13918

$18.00

A13918
[A13918]

A13918
hg38 Position: ChrY:14753907..14753907
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13918_F CCACTTTGTGTGTTGGGATG
Reverse Primer: A13918_R CTTGAGCCCAGGAAGTTGAG
Reviews

Customers who bought this product also purchased
A13920
A13920
A13925
A13925
A13919
A13919
A13924
A13924
A13917
A13917
A13923
A13923
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies