Top » Catalog » SNPs » A13920

$18.00

A13920
[A13920]

A13920
hg38 Position: ChrY:9260189..9260189
Ancestral: T
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13920_F CTCTCAACTTTTTGGTAGCCTATTTG
Reverse Primer: A13920_R AGTGCCCCCTCATGACAC
Reviews

Customers who bought this product also purchased
A13917
A13917
A13923
A13923
R1b-A1338 Willard Panel
R1b-A1338 Willard Panel
A13922
A13922
A13921
A13921
A13919
A13919
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies