Top » Catalog » SNPs » A13920

$18.00

A13920
[A13920]

A13920
hg38 Position: ChrY:9260189..9260189
Ancestral: T
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13920_F CTCTCAACTTTTTGGTAGCCTATTTG
Reverse Primer: A13920_R AGTGCCCCCTCATGACAC
Reviews

Customers who bought this product also purchased
A13921
A13921
A13919
A13919
A13925
A13925
A13918
A13918
A13924
A13924
A13917
A13917
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies