Top » Catalog » SNPs » A13921

$18.00

A13921
[A13921]

A13921
hg38 Position: ChrY:7001742..7001742
Ancestral: A
Derived: G
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13921_F AAAATTAGCTGGGCATGGTG
Reverse Primer: A13921_R TTGCAGCGAGAGCTATTGTC
Reviews

Customers who bought this product also purchased
A13918
A13918
A13924
A13924
A13917
A13917
A13923
A13923
R1b-A1338 Willard Panel
R1b-A1338 Willard Panel
A13922
A13922
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies