Top » Catalog » SNPs » A13921

$18.00

A13921
[A13921]

A13921
hg38 Position: ChrY:7001742..7001742
Ancestral: A
Derived: G
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13921_F AAAATTAGCTGGGCATGGTG
Reverse Primer: A13921_R TTGCAGCGAGAGCTATTGTC
Reviews

Customers who bought this product also purchased
A13922
A13922
A13920
A13920
A13919
A13919
A13925
A13925
A13918
A13918
A13924
A13924
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies