Top » Catalog » SNPs » A13924

$18.00

A13924
[A13924]

A13924
hg38 Position: ChrY:2799202..2799202
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13924_F AAGCAAGCTGATGGTGGTG
Reverse Primer: A13924_R GCCATAATGGGTGAGGAAAC
Reviews

Customers who bought this product also purchased
A13919
A13919
A13925
A13925
A13918
A13918
A13923
A13923
A13917
A13917
A13922
A13922
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies