Top » Catalog » SNPs » A13924

$18.00

A13924
[A13924]

A13924
hg38 Position: ChrY:2799202..2799202
Ancestral: G
Derived: A
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13924_F AAGCAAGCTGATGGTGGTG
Reverse Primer: A13924_R GCCATAATGGGTGAGGAAAC
Reviews

Customers who bought this product also purchased
R1b-A1338 Willard Panel
R1b-A1338 Willard Panel
A13921
A13921
A13920
A13920
A13919
A13919
A13925
A13925
A13918
A13918
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies