Top » Catalog » SNPs » A13925

$18.00

A13925
[A13925]

A13925
hg38 Position: ChrY:20666336..20666336
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13925_F TCTCCCTAGCCAGCCTCTTC
Reverse Primer: A13925_R CAGCAGAGGCAGCTTTATCC
Reviews

Customers who bought this product also purchased
A13924
A13924
A13918
A13918
A13923
A13923
A13917
A13917
A13922
A13922
R1b-A1338 Willard Panel
R1b-A1338 Willard Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies