Top » Catalog » SNPs » A13925

$18.00

A13925
[A13925]

A13925
hg38 Position: ChrY:20666336..20666336
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2016)
ISOGG Haplogroup: R1b
Comments: Below CTS4466 > A541 > Z21065 > A195 > A761 > Z16254 > A1338
Forward Primer: A13925_F TCTCCCTAGCCAGCCTCTTC
Reverse Primer: A13925_R CAGCAGAGGCAGCTTTATCC
Reviews

Customers who bought this product also purchased
R1b-A1338 Willard Panel
R1b-A1338 Willard Panel
A13921
A13921
A13920
A13920
A13919
A13919
A13924
A13924
A13918
A13918
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies