Top » Catalog » SNPs » Y600281

$19.00

Y600281
[Y600281]

Y600281
hg38 Position: ChrY:17114149..17114149
Ancestral: C
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below PH908 > Y486944
Forward Primer: Y600281_F CCTCAAAACTCTTCTTTAATCGATATG
Reverse Primer: Y600281_R CCTCATAAAATTCTTCACTCCAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies