Top » Catalog » SNPs » FTC61316

$19.00

FTC61316
[FTC61316]

FTC61316
hg38 Position: ChrY:8322509..8322509
Ancestral: A
Derived: G
Reference: FTDNA (2022)
ISOGG Haplogroup: E
Comments: Below M81 > CTS12227
Forward Primer: FTC61316_F GGACAGGCACACAGGTGAC
Reverse Primer: FTC61316_R TGAGCAAGAAGATGAGAGTCAAAC
Reviews

Customers who bought this product also purchased
BY8888
BY8888
M96
M96
BY8901
BY8901
E1b-L19 Panel
E1b-L19 Panel
Y338190
Y338190
MZ11
MZ11
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies