Top » Catalog » SNPs » BY3302

$18.00

BY3302
[BY3302]

BY3302
hg38 Position: ChrY:19532377..19532377
Ancestral: A
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S5488 > Z16282
Forward Primer: BY3302_F CTTGAACTCCCAACCACAGG
Reverse Primer: BY3302_R TTAATGTGTTGTTGGATTTGGC
Reviews

Customers who bought this product also purchased
mtComplete
mtComplete
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
R1a-Z280 Panel
R1a-Z280 Panel
YP237
YP237
BY32007
BY32007
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies