Top » Catalog » SNPs » Z16292

$18.00

Z16292
[Z16292]

Z16292
hg38 Position: ChrY:19180663..19180663
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Below DF21 > S5488 > Z16294
Forward Primer: Z16292_F CCCCAGTCCTTGCAATCAG
Reverse Primer: Z16292_R GGTTTACTTTAAGCCCTTGTTC
Reviews

Customers who bought this product also purchased
DF19
DF19
Y113338
Y113338
CTS9219
CTS9219
L1336
L1336
DF99
DF99
DF27
DF27
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies