Top » Catalog » SNPs » Z16292

$18.00

Z16292
[Z16292]

Z16292
hg38 Position: ChrY:19180663..19180663
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Below DF21 > S5488 > Z16294
Forward Primer: Z16292_F CCCCAGTCCTTGCAATCAG
Reverse Primer: Z16292_R GGTTTACTTTAAGCCCTTGTTC
Reviews

Customers who bought this product also purchased
M985
M985
P312
P312
U152
U152
R1b-Z2103 Panel
R1b-Z2103 Panel
FGC11134
FGC11134
BY12129
BY12129
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies