Top » Catalog » SNPs » Z16292

$18.00

Z16292
[Z16292]

Z16292
hg38 Position: ChrY:19180663..19180663
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Below DF21 > S5488 > Z16294
Forward Primer: Z16292_F CCCCAGTCCTTGCAATCAG
Reverse Primer: Z16292_R GGTTTACTTTAAGCCCTTGTTC
Reviews

Customers who bought this product also purchased
L513
L513
FGC14590
FGC14590
FGC33047
FGC33047
Z245
Z245
L21
L21
FGC14589
FGC14589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies