Top » Catalog » SNPs » A14079

$18.00

A14079
[A14079]

A14079
hg38 Position: ChrY:14118018..14118018
Ancestral: C
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > S971 > Z16267 > Z3000 > Z3004
Forward Primer: A14079_F CACTCCATAGCCAGGCTGTAC
Reverse Primer: A14079_R AGCATCTAAATTTGTTTCCTTTGC
Reviews

Customers who bought this product also purchased
DF13
DF13
R1b-DF21 Panel
R1b-DF21 Panel
Z3004
Z3004
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC41929
FGC41929
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies