Top » Catalog » SNPs » A14079

$18.00

A14079
[A14079]

A14079
hg38 Position: ChrY:14118018..14118018
Ancestral: C
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > S971 > Z16267 > Z3000 > Z3004
Forward Primer: A14079_F CACTCCATAGCCAGGCTGTAC
Reverse Primer: A14079_R AGCATCTAAATTTGTTTCCTTTGC
Reviews

Customers who bought this product also purchased
Z253
Z253
S5488
S5488
A7923
A7923
DF49
DF49
DF5
DF5
S953
S953
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies