Top » Catalog » SNPs » A9580

$18.00

A9580
[A9580]

A9580
hg38 Position: ChrY:8478179..8478179
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: R1b
Comments: Downstream R-U106+ S263+ S264+
Forward Primer: A9580_F GAGTTGACCTGGCCTTTGTC
Reverse Primer: A9580_R AGAACAGGCCAAGCAGAGG
Reviews

Customers who bought this product also purchased
DF98
DF98
FGC39801
FGC39801
DF96
DF96
Y18100
Y18100
Z381
Z381
Z306
Z306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies