Top » Catalog » SNPs » A9580

$18.00

A9580
[A9580]

A9580
hg38 Position: ChrY:8478179..8478179
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: R1b
Comments: Downstream R-U106+ S263+ S264+
Forward Primer: A9580_F GAGTTGACCTGGCCTTTGTC
Reverse Primer: A9580_R AGAACAGGCCAAGCAGAGG
Reviews

Customers who bought this product also purchased
FGC11662
FGC11662
Z18
Z18
S5520
S5520
S5556
S5556
L48
L48
S1911
S1911
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies