Top » Catalog » SNPs » A9580

$18.00

A9580
[A9580]

A9580
hg38 Position: ChrY:8478179..8478179
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: R1b
Comments: Downstream R-U106+ S263+ S264+
Forward Primer: A9580_F GAGTTGACCTGGCCTTTGTC
Reverse Primer: A9580_R AGAACAGGCCAAGCAGAGG
Reviews

Customers who bought this product also purchased
S5556
S5556
L48
L48
S1911
S1911
S3311
S3311
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
DF98
DF98
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies