Top » Catalog » SNPs » BY4461

$18.00

BY4461
[BY4461]

BY4461
hg38 Position: ChrY:18651305..18651305
Ancestral: G
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z5016 > Z38456
Forward Primer: BY4461_F AACTACTGAACTTAGAGAACAGACAAGC
Reverse Primer: BY4461_R GCACAGCATATGAACTTCATCTATG
Reviews

Customers who bought this product also purchased
Y97307
Y97307
Z17264
Z17264
S19928
S19928
BY4455
BY4455
BY4600
BY4600
Y161798
Y161798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies