Top » Catalog » SNPs » Y28669

$18.00

Y28669
[Y28669]

Y28669
hg38 Position: ChrY:11995117..11995117
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2a1c2b
Comments: Below FGC12305
Forward Primer: Y28669_F CTTCTTTTGCTTCCCCTGAG
Reverse Primer: Y28669_R TGCTAGCATGTGGCAGGTAG
Reviews

Customers who bought this product also purchased
Z156
Z156
S15627
S15627
JFS0006
JFS0006
L48
L48
S1688
S1688
Y14069
Y14069
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies