Top » Catalog » SNPs » Y28669

$18.00

Y28669
[Y28669]

Y28669
hg38 Position: ChrY:11995117..11995117
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2a1c2b
Comments: Below FGC12305
Forward Primer: Y28669_F CTTCTTTTGCTTCCCCTGAG
Reverse Primer: Y28669_R TGCTAGCATGTGGCAGGTAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies