Top » Catalog » SNPs » Y28669

$18.00

Y28669
[Y28669]

Y28669
hg38 Position: ChrY:11995117..11995117
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2a1c2b
Comments: Below FGC12305
Forward Primer: Y28669_F CTTCTTTTGCTTCCCCTGAG
Reverse Primer: Y28669_R TGCTAGCATGTGGCAGGTAG
Reviews

Customers who bought this product also purchased
S1688
S1688
Y14069
Y14069
Z381
Z381
Z301
Z301
FGC12305
FGC12305
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies