Top » Catalog » SNPs » ZP156

$18.00

ZP156
[ZP156]

ZP156
hg38 Position: ChrY:13228193..13228193
Ancestral: G
Derived: A
Reference: Peter Op den Velde Boots (2015)
ISOGG Haplogroup: R1b
Comments: Below Z18
Forward Primer: ZP156_F ATTGAGGCAAGCAGAAGTGG
Reverse Primer: ZP156_R CAAACCCAATGACAGCATTC
Reviews

Customers who bought this product also purchased
L257
L257
BY114278
BY114278
Z372
Z372
FGC5797
FGC5797
Z18
Z18
S11601
S11601
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies