Top » Catalog » SNPs » ZP156

$18.00

ZP156
[ZP156]

ZP156
hg38 Position: ChrY:13228193..13228193
Ancestral: G
Derived: A
Reference: Peter Op den Velde Boots (2015)
ISOGG Haplogroup: R1b
Comments: Below Z18
Forward Primer: ZP156_F ATTGAGGCAAGCAGAAGTGG
Reverse Primer: ZP156_R CAAACCCAATGACAGCATTC
Reviews

Customers who bought this product also purchased
S11601
S11601
Z381
Z381
DF95
DF95
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
ZP87
ZP87
S8402
S8402
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies