Top » Catalog » SNPs » S3515

$18.00

S3515
[S3515]

S3515
hg38 Position: ChrY:8224070..8224070
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1b1a
Comments: Below S7015
Forward Primer: S3515_F CGATTCCTCAAGGATCTAGATCTG
Reverse Primer: S3515_R ATTTTAATATAGAAAGAGACATCTTATGTGAAG
Reviews

Customers who bought this product also purchased
ZP91
ZP91
ZP258
ZP258
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
ZP257
ZP257
ZP136
ZP136
S7015
S7015
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies