Top » Catalog » SNPs » Z1941

$18.00

Z1941
[Z1941]

Z1941
hg38 Position: ChrY:8689673..8689673
Ancestral: T
Derived: G
Reference: Ray Banks (2012)
ISOGG Haplogroup: N1c1a1a2a1a
Comments: Equivalent to M178
Forward Primer: Z1941_F CAAAGCCTCCTGAAAAGTGC
Reverse Primer: Z1941_R ACGTTTCCTGGGTCACAAAG
Reviews

Customers who bought this product also purchased
VL60
VL60
VL72
VL72
Y17790
Y17790
Y31922
Y31922
BY30470
BY30470
Y20915
Y20915
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies