Top » Catalog » SNPs » FGC15940

$18.00

FGC15940
[FGC15940]

FGC15940
hg38 Position: ChrY:6805868..6805868
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15940_F TGGTAATTGCTACTTGAAGCAGG
Reverse Primer: FGC15940_R AATTCAGTGGGTCCCATGTC
Reviews

Customers who bought this product also purchased
FGC4415
FGC4415
Z640
Z640
FGC8224
FGC8224
FGC11
FGC11
Z1865
Z1865
FGC8223
FGC8223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies