Top » Catalog » SNPs » FGC15940

$18.00

FGC15940
[FGC15940]

FGC15940
hg38 Position: ChrY:6805868..6805868
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15940_F TGGTAATTGCTACTTGAAGCAGG
Reverse Primer: FGC15940_R AATTCAGTGGGTCCCATGTC
Reviews

Customers who bought this product also purchased
M215
M215
Y18570
Y18570
ZS1589
ZS1589
M96
M96
ZS6808
ZS6808
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies