Top » Catalog » SNPs » FGC15940

$18.00

FGC15940
[FGC15940]

FGC15940
hg38 Position: ChrY:6805868..6805868
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15940_F TGGTAATTGCTACTTGAAGCAGG
Reverse Primer: FGC15940_R AATTCAGTGGGTCCCATGTC
Reviews

Customers who bought this product also purchased
Z2324
Z2324
FGC58459
FGC58459
Z1889
Z1889
PF4869
PF4869
L858
L858
YSC0000076
YSC0000076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies