Top » Catalog » SNPs » FGC15940

$18.00

FGC15940
[FGC15940]

FGC15940
hg38 Position: ChrY:6805868..6805868
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15940_F TGGTAATTGCTACTTGAAGCAGG
Reverse Primer: FGC15940_R AATTCAGTGGGTCCCATGTC
Reviews

Customers who bought this product also purchased
ZS5606
ZS5606
FT164337
FT164337
V38
V38
ZS1585
ZS1585
ZS6807
ZS6807
L485
L485
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies