Top » Catalog » SNPs » FGC8223

$18.00

FGC8223
[FGC8223]

FGC8223
hg38 Position: ChrY:18968946..18968946
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC8224
Forward Primer: FGC8223_F GTGGGAGGATTGCTTGAGTC
Reverse Primer: FGC8223_R TGGTCTCAGCATCCAACTTTAC
Reviews

Customers who bought this product also purchased
ZS1585
ZS1585
ZS5604
ZS5604
Z18215
Z18215
ZS5597
ZS5597
BY93
BY93
FGC49240
FGC49240
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies