Top » Catalog » SNPs » FGC8223

$18.00

FGC8223
[FGC8223]

FGC8223
hg38 Position: ChrY:18968946..18968946
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC8224
Forward Primer: FGC8223_F GTGGGAGGATTGCTTGAGTC
Reverse Primer: FGC8223_R TGGTCTCAGCATCCAACTTTAC
Reviews

Customers who bought this product also purchased
M267
M267
ZS1766
ZS1766
ZS7075
ZS7075
ZS1706
ZS1706
ZS6239
ZS6239
FGC12
FGC12
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L1336
$18.00
Haplogroup Info
Other products
Currencies