Top » Catalog » SNPs » FGC8223

$18.00

FGC8223
[FGC8223]

FGC8223
hg38 Position: ChrY:18968946..18968946
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC8224
Forward Primer: FGC8223_F GTGGGAGGATTGCTTGAGTC
Reverse Primer: FGC8223_R TGGTCTCAGCATCCAACTTTAC
Reviews

Customers who bought this product also purchased
FGC67896
FGC67896
FGC22715
FGC22715
FGC67895
FGC67895
FT262752
FT262752
U175
U175
ZS6807
ZS6807
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies