Top » Catalog » SNPs » FGC8224

$18.00

FGC8224
[FGC8224]

FGC8224
hg38 Position: ChrY:19093140..19093140
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC8224_F GTCCAGTTTCTCTTGGAGGC
Reverse Primer: FGC8224_R CATAGGGGAAGGCAAGGAG
Reviews

Customers who bought this product also purchased
Z2324
Z2324
PF4869
PF4869
Z1889
Z1889
YSC0000076
YSC0000076
L858
L858
FGC15940
FGC15940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies