Top » Catalog » SNPs » ZS4242

$18.00

ZS4242
[ZS4242]

ZS4242
HG19 Position: ChrY:17610477..17610477
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream Z18229; Found in Big Y sample 303660
Forward Primer: ZS4242_F TTGACTGCAGTTCTCTGGAGC
Reverse Primer: ZS4242_R GACAAGTGTTAGTGAGGACGTGC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Z18231
Z18231
ZS11076
ZS11076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies