Top » Catalog » SNPs » BY5719

$18.00

BY5719
[BY5719]

BY5719
hg38 Position: ChrY:11927588..11927588
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a2
Comments: Below BY5715
Forward Primer: BY5719_F GAAACCAATGATACAACACGATG
Reverse Primer: BY5719_R GACAGGGTCTCAATCTGTCACTC
Reviews

Customers who bought this product also purchased
Z301
Z301
Z8172
Z8172
A656
A656
U106
U106
Z326
Z326
BY5716
BY5716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies