Top » Catalog » SNPs » BY5719

$15.00

BY5719
[BY5719]

BY5719
hg38 Position: ChrY:11927588..11927588
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a2
Comments: Below BY5715
Forward Primer: BY5719_F GAAACCAATGATACAACACGATG
Reverse Primer: BY5719_R GACAGGGTCTCAATCTGTCACTC
Reviews

Customers who bought this product also purchased
R1b-L48 Panel
R1b-L48 Panel
FGC18850
FGC18850
L48
L48
FGC18842
FGC18842
Z301
Z301
Z8172
Z8172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies