Top » Catalog » SNPs » BY5719

$18.00

BY5719
[BY5719]

BY5719
hg38 Position: ChrY:11927588..11927588
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a2
Comments: Below BY5715
Forward Primer: BY5719_F GAAACCAATGATACAACACGATG
Reverse Primer: BY5719_R GACAGGGTCTCAATCTGTCACTC
Reviews

Customers who bought this product also purchased
L47
L47
DF98
DF98
Z381
Z381
A5870
A5870
Z8
Z8
Z9
Z9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A559
1 x A466
1 x A600
1 x A817
1 x A770
1 x A2118
1 x A1279
1 x A442
1 x A903
1 x A2133
1 x A90
1 x A949
1 x A1318
1 x A1770
$252.00
Haplogroup Info
Other products
Currencies