Top » Catalog » SNPs » BY5719

$18.00

BY5719
[BY5719]

BY5719
hg38 Position: ChrY:11927588..11927588
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a2
Comments: Below BY5715
Forward Primer: BY5719_F GAAACCAATGATACAACACGATG
Reverse Primer: BY5719_R GACAGGGTCTCAATCTGTCACTC
Reviews

Customers who bought this product also purchased
Z8172
Z8172
A656
A656
U106
U106
Z326
Z326
BY5716
BY5716
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies