Top » Catalog » SNPs » FGC18850

$18.00

FGC18850
[FGC18850]

FGC18850
hg38 Position: ChrY:7779436..7779436
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a2
Comments: Below S21728, peer to A656 & BY5715
Forward Primer: FGC18850_F TTATCTGTCCCCGATTTGTTG
Reverse Primer: FGC18850_R CCCCTGTGTGTGGGTGTG
Reviews

Customers who bought this product also purchased
BY5719
BY5719
S21728
S21728
Z301
Z301
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Y67920
Y67920
L48
L48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies