Top » Catalog » SNPs » FGC18850

$18.00

FGC18850
[FGC18850]

FGC18850
hg38 Position: ChrY:7779436..7779436
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a2
Comments: Below S21728, peer to A656 & BY5715
Forward Primer: FGC18850_F TTATCTGTCCCCGATTTGTTG
Reverse Primer: FGC18850_R CCCCTGTGTGTGGGTGTG
Reviews

Customers who bought this product also purchased
S21728
S21728
Z301
Z301
BY5719
BY5719
A656
A656
U106
U106
L47
L47
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies